Part:BBa_K2486176
Synthetic Toehold Switch RNA with GFP
A synthetic toehold switch RNA coupled with GFP. This part is activated by a corresponding trigger RNA molecule.
In 2018 this part has been improved by Vilnius-Lithuania Overgraduate Team 2018 by making it free of green fluorescence protein. The improved biobrick [BBa_K2621011] can now be used to regulate the translation of any given coding sequence.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 734
Part improvement description (Vilnius-Lithuania Overgraduate 2018)
While designing the toehold sequence pairs we have noticed that there already is a highly similar toehold sequence in the form of a basic part (BBa_K2486176). That said, even though we believe this part consists of a well working toehold switch, it is combined with Green Fluorescent Protein. Therefore, it is impossible to use this toehold switch with any other coding part a scientist or an engineer would like to control.
That is why we, Vilnius-Lithuania Overgraduate 2018 team, have re-designed this part to make it accessible for everyone to use it as a real basic part for translational control. First of all, the downstream GFP gene sequence was removed from BBa_K2486176 to liberate the Toehold riboregulator sequence from a particular gene and make it autonomous to any part. Next, autonomous toehold sequences face a fundamental design flaw - they require the translation of gene to continue from one biobrick to another. However, by joining biobricks scar DNA sequences, containing STOP codon TAG are incorporated.
To overcome this problem, additional T nucleotide was added at the 3’ end toehold sequence. This additional nucleotide, together with a longer version of biobrick prefix sequence (gaattcgcggccgcttctagag) on the downstream gene block part are combined to allow the translation to continue from the toehold riboregulatory part to the controlled biobriock part as depicted in, for example BBa_K2621035.
The new and improved biobrick part is [BBa_K2621011].
None |